Review




Structured Review

ZenBio am1 zenbio n a differentiation medium
KEY RESOURCES TABLE
Am1 Zenbio N A Differentiation Medium, supplied by ZenBio, used in various techniques. Bioz Stars score: 93/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/am1 zenbio n a differentiation medium/product/ZenBio
Average 93 stars, based on 126 article reviews
am1 zenbio n a differentiation medium - by Bioz Stars, 2026-02
93/100 stars

Images

1) Product Images from "Stabilization of lncRNA GAS5 by a Small Molecule and Its Implications in Diabetic Adipocytes"

Article Title: Stabilization of lncRNA GAS5 by a Small Molecule and Its Implications in Diabetic Adipocytes

Journal: Cell chemical biology

doi: 10.1016/j.chembiol.2018.11.012

KEY RESOURCES TABLE
Figure Legend Snippet: KEY RESOURCES TABLE

Techniques Used: Recombinant, Lysis, Software



Similar Products

93
ZenBio am1 zenbio n a differentiation medium
KEY RESOURCES TABLE
Am1 Zenbio N A Differentiation Medium, supplied by ZenBio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/am1 zenbio n a differentiation medium/product/ZenBio
Average 93 stars, based on 1 article reviews
am1 zenbio n a differentiation medium - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell chemical biology

Article Title: Stabilization of lncRNA GAS5 by a Small Molecule and Its Implications in Diabetic Adipocytes

doi: 10.1016/j.chembiol.2018.11.012

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Donors N/A Additional tissue ZenBio ™ N/A Chemicals, Peptides, and Recombinant Proteins Fmoc-protected amino acids Chem-impex N/A TentaGel resin RAPP Polymere MB250002 Rink Amide-MBHA resin GL Biochem N/A 1-Hydroxybenzotriazole (HOBt) Oakwood Chemical Cat #24755 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) Oakwood Chemical Cat #024810 N -ethylmorpholine (NEM) Oakwood Chemical A0358553 5,5-Dimethyl-1,3-cyclohexanedione Oakwood Chemical Cat #011151 4,4’-Dimethoxytrityl Chloride Oakwood Chemical Cat #00118 4-(Bromomethyl)benzoic acid AK-Scientific Cat # 6232-88-8 3-Mercaptopropionic Acid Oakwood Chemical Cat # 094485 Benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP) Oakwood Chemical 009017 Fluorescein isothiocyanate Chemodex Cat # 00860 Erythrocyte lysis buffer Stem Cell Technologies N/A ASC medium ZenBio ™ Cat# PM-1 Adipocyte Medium, AM1 ZenBio ™ N/A differentiation medium, DM2 ZenBio ™ N/A RNA-Bee ™ Tel Test, Inc N/A Nucleofector ® solution Lonza N/A Critical Commercial Assays Omniscript ™ kit Qiagen N/A Glucose Uptake Fluorometric assay kit Sigma MAK084 Biotin Chromogenic Detection kit ThermoFisher N/A Experimental Models: Cell Lines adipose stem cells (ASC) ZenBio ™ N/A Oligonucleotides GAS5 sense primer 5’- CTTCTGGGCTCAAGTGATCCT -3’ anti-sense 5’ TTGTGCCATGAGACTCCATCAG -3’ This paper N/A IR-A sense primer 5’- GTTTTCGTCCCCAGGCCATC -3’ and anti-sense 5’ CCAACATCGCCAAGGGACCT -3’ This paper N/A IR-B sense primer 5’- CACTGGTGCCGAGGACCCTA -3’ and anti-sense 5’ GACCTGCGTTTCCGAGATGG -3’ This paper N/A IR promoter set 1 sense primer 5’- AGATCTCTGGCCATTGC ACTCCAG -3’ and anti-sense 5’ TTCAATAAACAGTTTGCTA GGAGC -3’ This paper N/A IR promoter set 2 sense primer 5’- TCGAGTCACCAAAATAAACAT -3’ and anti-sense 5’ TGCAGGGGAGGGAGGTGCCGC -3’ This paper N/A GAPDH sense primer 5’- TGACGTGCCGCCTGGAGAAAC -3’ and anti-sense 5’- CCGGCATCGAAGGTGGAAGAG -3’; This paper N/A CAT sense: 5’ GCCGCTGGCGATTCAG 3’ and antisense 5’ TTCATTAAGCATTCTGCCGACAT 3’ This paper N/A UPF1 sense: 5’ AGATCACGGCACAGCAGAT 3’ and antisense 5’ TGGCAGAAGGGTTTTCCTT 3’ This paper N/A U1snRNA sense: 5’ TCCCAGGGCGAGGCTTATCCATT 3’ and antisense 5’ GAACGCAGTCCCCCACTACCACAAAT 3’ This paper N/A Software and Algorithms Compass software ProteinSimple https://www.proteinsimple.com/compass/downloads/ Excel ™ Microsoft Office https://office.microso1tcom/excel/ PRISM ™ Graphpad Software https://www.graphpad.com/scientific-software/prism/ OriginPro OriginLab https://www.originlab.com/ Open in a separate window KEY RESOURCES TABLE ncRNA GAS5 regulates expression of insulin receptor in adipocytes.

Techniques: Recombinant, Lysis, Software